Review



atcc crl 1628 293t type culture collection  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    ATCC atcc crl 1628 293t type culture collection
    Atcc Crl 1628 293t Type Culture Collection, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1351 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atcc+crl+1628+293t+type+culture+collection/SCC-25/pm41831232-199-51-51
    Average 97 stars, based on 1351 article reviews
    atcc crl 1628 293t type culture collection - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    RNA Sequencing:

    Article Title: Nociceptive neurons protect cancer cells against oxidative stress.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-seq data of co-cultured cancer cells and TG neurons This paper OMIX013255 (https://ngdc.cncb.ac.cn/ omix/release/OMIX013255); OMIX013256 (https://ngdc.cncb.ac.cn/ omix/release/OMIX013256) Experimental models: Cell lines HN4 University of Maryland Dental School N/A HN6 University of Maryland Dental School N/A CAL27 ATCC Cat# ATCC-CRL-2095 SCC9 ATCC Cat# ATCC-CRL-1629 SCC25 ATCC Cat# ATCC-CRL-1628 293T Type Culture Collection of Chinese Academy of Sciences Cat#GNHu17 NOK1 This paper N/A MC57G ATCC Cat#CRL-2295 Experimental models: Organisms/strains Mouse: BALB/c-nude Shanghai Model Organisms Center N/A Mouse: C57BL/6 Shanghai Model Organisms Center N/A Oligonucleotides Human NFE2L2 siRNA-1: GAGACUACCAUGGUUCCAAUU UUGGAACCAUGGUAGUCUCUU This paper N/A Human NFE2L2 siRNA-2: CCAAAGAGCAGUUCAAUGAUU UCAUUGAACUGCUCUUUGGUU This paper N/A Human NFE2L2 siRNA-3: GCCCUCACCUGCUACUUUAUU UAAAGUAGCAGGUGAGGGCUU This paper N/A Human Lnc-GCLC-1 siRNA-1: GCACUGGCAUAACAUACUUUU AAGUAUGUUAUGCCAGUGCUU This paper N/A Human Lnc-GCLC-1 siRNA-2: GAGAUAGACUGACCUAACUUU AGUUAGGUCAGUCUAUCUCUU This paper N/A Human Lnc-GCLC-1 siRNA-3: GCAUCUUCUGCAAAUGCUAUU UAGCAUUUGCAGAAGAUGCUU This paper N/A Human ETV4 siRNA-1: CUCCGAUACUAUUAUGAGAUU UCUCAUAAUAGUAUCGGAGUU This paper N/A Human ETV4 siRNA-2: GGUGAGCGUUACGUGUACAUU UGUACACGUAACGCUCACCUU This paper N/A Human ETV4 siRNA-3: GGCCAGCCAUGAAUUACGAUU UCGUAAUUCAUGGCUGGCCUU This paper N/A Mouse Ereg siRNA-1: CUCAUCAUAACCGCUGGAUUU AUCCAGCGGUUAUGAUGAGUU This paper N/A Mouse Cxcl1 siRNA-1: GUCAGUGCCUGCAGACCAUUU AAUGGUCUGCAGGCACUGACUU This paper N/A Mouse Cxcl10 siRNA-1: GUCUGAAUCCGGAAUCUAAUU UUAGAUUCCGGAUUCAGACUU This paper N/A (Continued on next page) Cell Reports 45, 117086, March 24, 2026 19 ..



    Similar Products

    97
    ATCC atcc crl 1628 293t type culture collection
    Atcc Crl 1628 293t Type Culture Collection, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atcc+crl+1628+293t+type+culture+collection/SCC-25/pm41831232-199-51-51
    Average 97 stars, based on 1 article reviews
    atcc crl 1628 293t type culture collection - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    Image Search Results